Knowee
Questions
Features
Study Tools

Darshan wants to set up a PCR reaction for his gene of interest. The sequence of the DNA strand is as follows: Template strand: 5’ ACTGCGTATGCCGATCGTATGCCGTATGC 3’ What should be the annealing temperature should he set in the thermal cycler for successful conduct of the experiments? [Hint: The forward primer consists of 14 bases] 44°C 72°C 94°C 56 °C

Question

Darshan wants to set up a PCR reaction for his gene of interest. The sequence of the DNA strand is as follows: Template strand: 5’ ACTGCGTATGCCGATCGTATGCCGTATGC 3’ What should be the annealing temperature should he set in the thermal cycler for successful conduct of the experiments? [Hint: The forward primer consists of 14 bases] 44°C 72°C 94°C 56 °C

🧐 Not the exact question you are looking for?Go ask a question

Solution

The annealing temperature for PCR is typically calculated based on the Tm (melting temperature) of the primers being used. The Tm is the temperature at which half of the DNA duplex will dissociate to become single stranded, and it depends on both the length of the DNA strand and its specific nucleotide sequence.

The general rule of thumb for calculating the Tm of a primer is to add 2°C for every A or T nucleotide, and 4°C for every C or G nucleotide.

Given that the forward primer consists of 14 bases, we can't calculate the exact Tm without knowing the specific sequence of the primer. However, a typical annealing temperature for a 14-base primer might be around 50-60°C.

Therefore, out of the options provided, 56°C would be the most appropriate annealing temperature for Darshan to set in the thermal cycler.

This problem has been solved

Similar Questions

The temperature used for the annealing step in a PCR cycle should be approximately what? 95°C 0°C 100°C above the Tm of the primers 5°C below the Tm of the primers 100°C below the Tm of the primers

Organize the following steps of a PCR cycle in the correct sequence.The mixture is cooled to allow the binding of primers to the end of target DNA sequences.Free nucleotides are added in the 5’ to 3’ direction by the Taq DNA polymerase.The reaction mixture is heated to separate the double-stranded DNA.Group of answer choices1, 2, 31, 3, 22, 1, 32, 3, 13, 1, 23, 2, 1

You are programming a thermocycler and are setting temperature of the second step in your protocol to 62°C. What is happening during this step?ANSWERIt separates double-stranded DNA into single strands that can be copied.It allows the primers to anneal.Nothing is happening at this temperature, as DNA replication is halted.The temperature allows DNA polymerase to copy the target DNA.

The PCR reaction is based on A. DNA replication B. Temperature cycles C. Copies of a target DNA sequence D. All the options

Which of the following correctly matches the step of polymerase chain reaction (PCR) with its events?Choose 1 answer:Choose 1 answer:(Choice A)   Extension - reaction is cooled and primers bind to complementary sequences on template DNA.AExtension - reaction is cooled and primers bind to complementary sequences on template DNA.(Choice B)   Annealing - Taq polymerase extends the primers, synthesizing DNABAnnealing - Taq polymerase extends the primers, synthesizing DNA(Choice C, Checked)   Denaturation - high temperature separates the DNACDenaturation - high temperature separates the DNA

1/1

Upgrade your grade with Knowee

Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.