The temperature used for the annealing step in a PCR cycle should be approximately what? 95°C 0°C 100°C above the Tm of the primers 5°C below the Tm of the primers 100°C below the Tm of the primers

Darshan wants to set up a PCR reaction for his gene of interest. The sequence of the DNA strand is as follows: Template strand: 5’ ACTGCGTATGCCGATCGTATGCCGTATGC 3’ What should be the annealing temperature should he set in the thermal cycler for successful conduct of the experiments? [Hint: The forward primer consists of 14 bases] 44°C 72°C 94°C 56 °C

You are programming a thermocycler and are setting temperature of the second step in your protocol to 62°C. What is happening during this step?ANSWERIt separates double-stranded DNA into single strands that can be copied.It allows the primers to anneal.Nothing is happening at this temperature, as DNA replication is halted.The temperature allows DNA polymerase to copy the target DNA.

Organize the following steps of a PCR cycle in the correct sequence.The mixture is cooled to allow the binding of primers to the end of target DNA sequences.Free nucleotides are added in the 5’ to 3’ direction by the Taq DNA polymerase.The reaction mixture is heated to separate the double-stranded DNA.Group of answer choices1, 2, 31, 3, 22, 1, 32, 3, 13, 1, 23, 2, 1

Which of the following are the three steps (in order) of PCR? A. denaturation, annealing, extension B. extension, annealing, denaturation C. denaturation, extension, annealing D. annealing, denaturation, extension

For specified limits of the maximum and minimum temperatures, the ideal cycle with the lowest thermal efficiency isQuestion 4Select one:a.Carnotb.Stirlingc.Ericssond.Diesele.All are the same