5’- ACAGTCCTTAAGCAAGATAGGTCTAAGATTGCAG-3’ What would be the m-RNA sequence that is complementary to above sequence?
Question
5’- ACAGTCCTTAAGCAAGATAGGTCTAAGATTGCAG-3’ What would be the m-RNA sequence that is complementary to above sequence?
Solution
The mRNA sequence that is complementary to the given DNA sequence would be:
5'- UGUCAGGAAUUCGUUCUAUCCAGAUUCUAACGUC -3'
Here's how you get it:
-
Transcription is the process where a segment of DNA is copied into RNA by the enzyme RNA polymerase.
-
In this process, the DNA sequence is read from the 3' to the 5' end and the mRNA is synthesized in the 5' to 3' direction.
-
The RNA molecule is complementary to the DNA strand, meaning that for every adenine (A) in the DNA, there will be an uracil (U) in the RNA. For every cytosine (C), there will be a guanine (G), and vice versa.
-
Therefore, to get the mRNA sequence, you simply replace all the A's in the DNA sequence with U's, all the T's with A's, all the C's with G's, and all the G's with C's.
-
So, the DNA sequence 5’- ACAGTCCTTAAGCAAGATAGGTCTAAGATTGCAG-3’ would transcribe to the mRNA sequence 5'- UGUCAGGAAUUCGUUCUAUCCAGAUUCUAACGUC -3'.
Similar Questions
The complementary messenger RNA strand that would be synthesized from the DNA template sequence of 5' CTGAC 3' would be _________blank.Multiple Choice3' AGTUG 5'5' GACGU 3'3' GACTG 5'5' UGACU 3'3' GACUG 5'
Given the following DNA strand, which of the following is its complementary mRNA? G G A C T G A T T1 pointC C T G A C T A AC C U G A C U A AG G A C T G A T TT T A G T C A G G
If the nontemplate strand of a gene in E. coli had the sequence: 5 ′ -TTGACA-(18 bases)-TATAAT-(8 bases)-GCCTTCCAGTG-3 ′ what nucleotide sequence would be present in the RNA transcript of this gene?
Here is the sequence of a template strand in the middle section of a gene.5' GATTTC 3' What is the mRNA sequence of this section of the gene? Group of answer choices5' CUAAAG 5'5' GAAAUC 3'5' CUUUAG 3'5' GAUUUC 3'
5’ TAG TTT CGA TCT GGA 3’ 1. Here is the coding sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the mRNA sequence of this section of gene? (1 mark)
Upgrade your grade with Knowee
Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.