Knowee
Questions
Features
Study Tools

Which of the following 10-base primers would base-pair with this single-stranded DNA sequence?3' GATCGTAACTACAGGCGTAGCTGACGTGTCCASelect all that apply.Group of answer choices3' GATCGTAACT5' GATCGTAACT3' CTAGCATTGA5' CTAGCATTGA5' GACGTGTCCA

Question

Which of the following 10-base primers would base-pair with this single-stranded DNA sequence?3' GATCGTAACTACAGGCGTAGCTGACGTGTCCASelect all that apply.Group of answer choices3' GATCGTAACT5' GATCGTAACT3' CTAGCATTGA5' CTAGCATTGA5' GACGTGTCCA

🧐 Not the exact question you are looking for?Go ask a question

Solution

The process of base pairing in DNA involves the formation of hydrogen bonds between complementary bases. Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C).

Given the single-stranded DNA sequence 3' GATCGTAACTACAGGCGTAGCTGACGTGTCCA, we need to find the 10-base primers that would base-pair with it.

  1. 3' GATCGTAACT: This primer will not base-pair with the given sequence because it is identical to the first 10 bases of the given sequence. For base pairing, we need a sequence that is complementary, not identical.

  2. 5' GATCGTAACT: This primer will base-pair with the given sequence. It is the reverse complement of the first 10 bases of the given sequence.

  3. 3' CTAGCATTGA: This primer will not base-pair with the given sequence. It is neither identical nor complementary to any 10-base segment of the given sequence.

  4. 5' CTAGCATTGA: This primer will not base-pair with the given sequence. It is neither identical nor complementary to any 10-base segment of the given sequence.

  5. 5' GACGTGTCCA: This primer will base-pair with the given sequence. It is the reverse complement of the last 10 bases of the given sequence.

So, the 10-base primers that would base-pair with the given single-stranded DNA sequence are 5' GATCGTAACT and 5' GACGTGTCCA.

This problem has been solved

Similar Questions

The DNA sequence 5' ATGCATGC 3' will pair with which of the following DNA strands?Multiple Choice3' TACGTACG 5'3' TACCTACC 5'3' ATGCATGC 5'3' TTGCATCC 5'3' CGTACGTA 5'

If the sequence of bases in the template strand of a DNA molecule is 3' ATCGCTCC 5', what is the sequence of bases in the RNA that is transcribed from this molecule?Multiple Choice5' AUCGCUCC 3'3' UAGCGAGG 5'3' TAGCGAGG 5'5' UAGCGAGG 3'5' TAGCGAGG 3'

During transcription, which of the following shows the correct complementary base pairing of DNA with mRNA?Group of answer choicesA-U and G-CC-A and G-TC-C, G-G, A-A and T-TC-T and A-GA-T and G-C

There are four different bases in DNA, which always pair up in a particular way. Which of the following shows the correct complementary base pairing? A-X and G-CT-A and G-CA-A, C-C, T-T and G-GA-G and T-C

According to the base pairing rules of DNA, if the sequence of bases on one strand was AGGCTTA, what would be the sequence of bases on the complementary strand?

1/3

Upgrade your grade with Knowee

Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.