Knowee
Questions
Features
Study Tools

Write a code for reading FASTA sequence with Bio.Fasta packag

Question

Write a code for reading FASTA sequence with Bio.Fasta packag

🧐 Not the exact question you are looking for?Go ask a question

Solution

Sure, here is a simple Python code snippet using the BioPython package to read a FASTA file:

from Bio import SeqIO

def read_fasta_file(file_path):
    for record in SeqIO.parse(file_path, "fasta"):
        print("ID: ", record.id)
        print("Sequence: ", record.seq)
        print("Length: ", len(record))

# Call the function with your fasta file path
read_fasta_file("your_file_path.fasta")

In this code:

  1. We first import the necessary module SeqIO from the Bio package.
  2. We define a function read_fasta_file that takes a file path as an argument.
  3. Inside the function, we use SeqIO.parse to read the fasta file. This function returns an iterator giving SeqRecord objects.
  4. For each SeqRecord, we print out its ID, sequence, and length.
  5. Finally, we call the function with the path to your fasta file.

Please replace "your_file_path.fasta" with the path to your actual FASTA file.

This problem has been solved

Similar Questions

WAP for reading a sequence file from D: drive, convert it into a FASTA format and save in a diff file at C: drive with name protein.fasta

Write the protein sequence in one-letter code that would be synthesized. (1 mark)      5’-ATGGCTGGGTGCTTTTAA-3’

Using the genetic code table, write out a mRNA sequence that could be used as a code to make the following protein:                         Met - Pro - Arg

Will any adaptor sequences be removed from the reads by default by the fastp program?Group of answer choicesYesNo

Transcribe and translate the following DNA sequence (don't forget about START and STOP codons):ACGGTACCCCGGGACTGACTTGCA aMet - Ser - Gly bMet - Pro - Gly cThr - Gly - Ser dCys - His - Gly - Ala - Leu - Thr - Glu - Arg eLeu - Thr - Glu - Arg fMet - Gly - Pro gCys - His - Gly - Ala - Leu hThr - Ser - Gly

1/1

Upgrade your grade with Knowee

Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.